jkam556 jkam556
  • 04-06-2018
  • World Languages
contestada

what is P(A^B^C)
HELP!!!!!!!!!!!!!!!!!!

what is PABC HELP class=

Respuesta :

tonb
tonb tonb
  • 04-06-2018
The sum of all numbers is 50. Let's say there have been 50 events, for which property A, B or C holds.

In the center of A, B and C, there is the number 8, which would mean that for 8 out of 50 events, all three properties hold.

The chance of this happening is 8/50 = 4/25 = 0.16
Answer Link

Otras preguntas

A line passes through the point (-9, 5) and has a slope of 4/3. Write an equation in point-slope form for this line.
Solve this equation for N. 3N + 5 = 38
A book sold 33,400 coples in its first month of release. Suppose this represents 7.6% of the number of coples sold to date. How many coples have been sold todat
A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.
Solve the equation, give the exact solution then approximate the solution to the nearest hundredth
which expression means the same as an increase of 20%
Show that the equation is not an identity by finding a value of x for which both sides are defines but not equal.
The functions f(x) and g(x) are shown on the graph.F(x)=x^2What is g(x)?A. g(x)= -x^2+3B. g(x)=(-x)^2-3C. g(x)=(-x)^2+3D.g(x)= -x^2-3
use the information to find the value cot 0 =
If it takes 6.2 pounds of seed to plant one acre of grass, how many acres can be planted with 9.92 pounds of seed?