jasmine2720
jasmine2720 jasmine2720
  • 03-10-2021
  • Mathematics
contestada

Helppp mee pleaseeeeeeeeeeeeeee

Helppp mee pleaseeeeeeeeeeeeeee class=

Respuesta :

taylonerikson
taylonerikson taylonerikson
  • 03-10-2021

Answer:

x=10

Step-by-step explanation:

98+33=131

131+9=140

180-140=40

40/4=10

x=10

Answer Link
nicole1loveshorses nicole1loveshorses
  • 03-10-2021
I think it would be x=10
Answer Link

Otras preguntas

what is 3/5 of 21? plz answer the question
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
1. Find the missing side length. A. 12 in B. 15 in C. 17 in D. 21 in 2. Find the missing side length. A. 25 m B. 20 m C. 75 m D. 100 m
*The sum of two numbers is 400. If the first number is decreased by 20% and the second number is decreased by 15%, then the sum would be 68 less. Find the numbe
Solve the equation. Identify any extraneous solutions. x=sqrt2x+24 6 and 4 are both extraneous solutions. 4 is a solution to the original equation. The value –6
Please help ASAP!!!! 100 points!
You must have your insurance ID card with you every time you drive in Florida. A. True B. False
Which of the following is true about a writer’s diction? a.When the writer uses sophisticated vocabulary, the diction is informal. b.When the writer uses comple
Read the passage from “Cruel Tribute.” Years passed by. Every spring when the roses began to bloom seven youths and seven maidens were put on board of a black-s
Which tortoises, mainland or island, need to eat more food per gram of their body mass?