ash24 ash24
  • 03-04-2015
  • Biology
contestada

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

Respuesta :

flyingcaprinekid
flyingcaprinekid flyingcaprinekid
  • 04-04-2015


the matching (complementary) strand would be:

ATGCCATTCGTAGAACCGTATTGGGGTTAA

Answer Link

Otras preguntas

Give an example of a relation in real life, and explain why it’s a function.
Lila wrote an equation of the cost for printing brochures, where x represents the number of brochures and y represents the total cost. The total cost for 35 bro
how do u solve this: Tamara was charged for two bags that were over the weight limit and another bag that was over the size limit. Write and evaluate a numerica
Which of the following salts will be less soluble in 0.10 M NaCl than it is in pure water? PbF2 CaCO3 All of the options are less soluble in 0.10 M NaCl than in
2. 100 g of liquid water is at 10°С. Find the number of calories it takes to heat this up this liquid water to 100°C using this information. 100°C 10°C
how can we say that the food has become a global culture​
A person suffered a head injury, was unconscious for a few minutes, and is now sleepy and disoriented. This person likely o A. is intoxicated. OB. has a concuss
campaign and advocacies must be able to persuade its target audience to agree to its vision and mission​
Owen earns $27,980 per year in take-home pay. What is the most money a housing expert would advise him to spend on a monthly mortgage payment? O A. $2798.00 B.
can some won help me pls