madison07pharris madison07pharris

04-01-2016
Mathematics

contestada

what is the ratio to feet on a measuring tape

Respuesta :

Аноним Аноним

04-01-2016

It would be 12 inches in a foot, so therefore 12:1 (12 to 1)
Hope this will help!:)

Answer Link

muskan13 muskan13

04-01-2016

it will be 12 inches for your answer

clue is 12:1

Answer Link

Otras preguntas

Given the following table of grades from Mrs. Hardcase's English classes:Write the notation, then answer as a fraction, decimal percent3. What is the probabilit

Geometry question - Given: AB and AC are the legs of isosceles triangle ABC, measure of angle 1 = 5x, measure of angle three = 2x + 12. Find measure of angle 2

I need the POTD (problem of the day) explained please

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.

5. Logan is cooking carrots as part of his dinner. He is in a rush so he wants them to cook as fast as possible. He decides to cut them into small pieces so the

If AABC is similar to ARST, find the value of x.

can I get help with the MG row I’m having a hard time to understand

Maria Works in a local pharmacy and must prepare a stock of a drug solution for local veterinarian the pharmacy has in stock 3 l of the drug solution and the ve

Using the z score formula use the information below to find the value of

Which of the following represents the graph of f(x) = 3^x + 1?