retashayork retashayork
  • 04-09-2014
  • Mathematics
contestada

How do you write a word form for 4.293

Respuesta :

asdfasdf
asdfasdf asdfasdf
  • 04-09-2014
four and two hundred ninety-three thousandths
Answer Link
jaimebear02 jaimebear02
  • 09-09-2014
Four and two hundred ninety three thounds hope it helps
Answer Link

Otras preguntas

when Jefferson took office he did what
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.
What is the difference between "Herr" and "Herrn"?
which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
Express the perimeter of the triangle as a polynomial. 8x+2 5x-4 9x+3