wilson7b wilson7b
  • 04-03-2022
  • Mathematics
contestada

A stack of 9 books weighs 5.4 pounds. If each book weighs the same amount, how much does each book weigh?

Respuesta :

liamhudson310
liamhudson310 liamhudson310
  • 04-03-2022
Each book would weigh 0.6, I’m not entirely sure if that is right
Answer Link

Otras preguntas

The type and age of rocks found in the mountain range are also found on another continent. What might this mean?
HELPPPPP 35% OF GRADEEEEE.... When John bought his new computer, he purchased an online computer help service. The help service has a yearly fee of $25.50 and a
testosterone directly affects the
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
Please answer theses division problems!! 9 divided by 3/7
Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
31+34=90-n 45+1=70-k 6×9=41+m