ahunt8283 ahunt8283
  • 02-04-2018
  • History
contestada

What prompted kennedy to push for changes in civil rights prior to 1964?

Respuesta :

shawnlitten
shawnlitten shawnlitten
  • 11-04-2018

John Fitzgerald Kennedy pushed for changes in civil rights and general societal changes during this period following a myriad of violent demonstrations that ensued in the Southern regions of America. Such civil changes were tailored towards alleviating discrimination against black Americans in the South.

Answer Link

Otras preguntas

The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
accurate estimation 719-348
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
Who was the Queen of England when Shakespeare first became known as a great playwright? A. Elizabeth I B. Mary Tudor C. Victoria D. Anne Boleyn
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
Do you think then solid can undergo convection
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
Susan ........ (Run) to school because she was late.
p(x) x^3+x^2-x-1 Find all zeros of p (x)